Skip to main content

Table 3 Target genes that shRNA were significantly depleted.

From: Systems analysis of quantitative shRNA-library screens identifies regulators of cell adhesion

Gene P-value T-statistics Entrez Gene Significant GO term GO category shRNA sequence
ABCB7 0.0019 -16.2715 22 heme transporter activity MF 5'GAATGCCACATGGATATGACACCCAAG3'
RFXANK 0.0027 -13.5118 8625 humoral immune response BP 5'GGAGAGATTGAGACCGTTCGCTTCCTG3'
CD28 0.0031 -12.5570 940 humoral immune response BP 5'GAACTGTTGGATTTACCCTGGCACGTG3'
ASMT 0.0035 -11.8293 438 melatonin biosynthesis; acetylserotonin O-methyltransferase activity BP/MF 5'GCATGACTGGCCAGACGACAAAGTCCA3'
PPYR1 0.0039 -11.2743 5540 neuropeptide Y receptor activity MF 5'GCATCCATTTGCATCGTGAAGACTGGC3'
CKB 0.0053 -9.6779 1152 creatine kinase activity MF 5'GCTGCGGGCAGGTGTCGATATCAAGCT3'
SPOCK3 0.0066 -8.6420 50859 enzyme inhibitor activity MF 5'TAGTGCTTGGGATCGTACATGTTAATT3'