Skip to main content

Table 2 Gene-specific primers for RT-PCR-based expression analysis of PDE1C and G(olf)

From: Evolution of multiple phosphodiesterase isoforms in stickleback involved in cAMP signal transduction pathway

Target gene Sequence (5' → 3')a Product length (base pairs)
Stickleback PDE1Ca Forward: ATGGTGCATTGGTTGACTGA 233
  Reverse: CTCCAGTCGTCCTTGGAGAG  
Stickleback PDE1Cb1 Forward: CAAGGGCTTCAAGGTCACAT 152
  Reverse: CCTTTTCCTCCAGGTCTTCC  
Stickleback PDE1Cb2 Forward: ACAGACGGACCTCCAACATC 238
  Reverse: TGTTTGCTGTAGCCCACTTG  
Stickleback PDE1Cb3 Forward: CAAAGGCTTGTCCCTGCTAC 217
  Reverse: TGGTTCCACCATGAAGTCAA  
Stickleback PDE1Cb4 Forward: TGGGCTACAGCAAACACAAG 243
  Reverse: AGTTCTCCAAAGCTCGGTCA  
Stickleback PDE1Cb5 Forward: CACTGGCTCAGTGAGTTGGA 185
  Reverse: CTGTGCTGTAGAAGGCGACA  
Stickleback PDE1Cb6 Forward: CACTGGCTCAGTGAGTTGGA 239
  Reverse: AGCTCTCTGCTCCACTCGTC  
Stickleback PDE1Cb7 Forward: CTCCTTGGAAGTGGGCTACA 230
  Reverse: TGTACAACATGGCGGTGTCT  
Stickleback G(olf) Forward: SAGCAGCAGCTACAACATGG 411
  Reverse: CATTCKCTGGATGATGTCMC  
  1. a Positions with mixed bases are designated by their IUB (the International Union of Biochemistry) codes: R = A/G; Y = C/T; K = G/T; M = A/C; S = G/C; W = A/T.