Skip to main content

Advertisement

Table 1 Primers used in this study

From: Integration of transcriptional inputs at promoters of the arabinose catabolic pathway

Primer Name Sequence
araB3' CATACTCGAGCCATTCAGAGAAGAAACCAA
araB5' GATGCGGCCGCAGTGACGGCAATGTCTGAT
araC3' GATGCGGCCGCCGTCAATTGTCTGATTCGT
araC5' GATGCGGCCGCAGTGACGGCAATGTCTGAT
araE3' GGGGATCCGGCGTTAAAGCAGATTCCGTAT
araE5' CGCCTCGAGCCGTGGATGGCGGTTGGCTGG
araF3' CCCCGGATCCCAGACCAATGGCTGCCAGGG
araF5'short CCGCTCGAGCGGTTATTACACCATTTC
sigARARS ATGGATCCTAGTAGCATTTTTATCCATAAGATTAGCGATCCTACCTGAGGAGCCAATTCACG
araCI1I2 ATGGATCCTAGTAGCATTTTTATCCATAAGATTAGCGATCCTACCTGAGGAGCCAATTGCACG
araCI2I2 ATGGATCCTAGTAGCCGATTCTACCTGATCTATAGCCGATTCTACCTGAGGAGCCAATTGCACG
araCDI1I2 ATGGATCCTAGNAGCNTTTTTATCNATATCTATAGCCGATTCTACCTGAGGAGCCAATTGCACG
araCI1I1 ATGGATCCTAGTAGCATTTTTATCCATAAGATTAGCATTTTTATCCATAGGAGCCAATTGCACG
araCDI2DI2 ATGGATCCTAGTNGCCGATTCTACNTGATCTATNGCCGATTCTACNTGAGGAGCCAATTGCACG
sigCRP GGATCCTAGAATNGTGNTCTNAATCACATNTGGAGCCAATTGCACG