Skip to main content

Table 1 List of primers used in RT-PCR reactions.

From: Astrocyte - neuron lactate shuttle may boost more ATP supply to the neuron under hypoxic conditions - in silico study supported by in vitro expression data

Transcript amplified Primer sequence
(F 5'to 3'; R 5'to 3')
Product length Tm (°C) Cycle #
PK (pyruvate kinase) F: AGTCGGAGGTGGAAATTGTG
R. AGGTCCACCTCAGTGTTTGG
267 bp 60 45
HK (hexokinase) F: CAGGGTCTGAGCAAGGAGAC
R: GCTTCCTTCAGCAAGGTGAC
430 bp 60 45
PFK(phosphofructokinase) F: CACCATCAGCAACAATGTCC
R: AGTCGTGGATGTTGAAAGGG
242 bp 60 40
GAPDH (Glyceraldehydephosphate dehydrogenase) F: TCG GAG TCA ACG GAT TTG G
R: GCA TTG CTG ATG ATC TTG AGG
500 bp 50 30
CS (citrate synthase) F: AAGGCTAAAGGTGGGGAAGA
R: CCATTCATAGCTGCTGCAAA
565 bp 54 35
Beta-actin F: GGCTTTAGGAGCTTGACAATACTG
R: GCATTGGTCACCTTTAGATGGA
511 bp 60 30