Skip to main content

Table 3 Primer pairs for qPCR

From: More than just a metabolic regulator - elucidation and validation of new targets of PdhR in Escherichia coli

Binding site Sequence 5'-3'  
PdhRop CACAGTTTCATGATTTC +
  GAGAGTGCCTTCGAG -
GlcDop CGGACCTCGTGCACAG +
  GTGCCATCAGTACCG -
MraZop AACGGTGATGACGATG +
  GGTAGGCACTGATAAG -
MetBop GTGTAATGCACCTGTC +
  AACCCGCTACGCACTG -
YnfMop ATGCAGCTCTTCCGC +
  TTCTCAGTGTCGCTTG -
PtsGop GTCGGTAAATCGCTGATGCTGCC +
  CAACAACTGCGGCCAGCGC -