Skip to main content

Table 4 Fluorescence labeled primers for gel shift assays

From: More than just a metabolic regulator - elucidation and validation of new targets of PdhR in Escherichia coli

Binding site Sequence 5'-3' Label
PdhRop GCCGAAGTCAATTGGTCTTACCAATTTCATGTCTGTG 5'DY682
  CACAGACATGAAATTGGAAGACCAATTGACTTCGGC 5'DY782
GlcDop CTATCTCTTTAGCTACCGGTCAGACCATTTTTTTTCCAGCTCT 5'DY682
  AGAGCTGGAAAAAAAATGGTCTGACCGGTAGCTAAAGAGATAG 5'DY782
MraZop TCGGTATGCCTTGTGACTGGCTTGACAAGCTTTTCCTCAGCTCC 5'DY682
  GGAGCTGAGGAAAAGCTTGTCAAGCCAGTCACAAGGCATACCGA 5'DY782
MetBop AACGGCTATTTGGGATTTGCTCAATCTATACGCAAAGAAGTTT 5'DY682
  AAACTTCTTTGCGTATAGATTGAGCAAATCCCAAATAGCCGTT 5'DY782