Skip to main content

Table 4 Three of human encoded miRNA sequences used in this study as examples

From: A computational method for predicting regulation of human microRNAs on the influenza virus genome

miRNA Sequence
>hsa-miR-576-3p MIMAT0004796 AAGAUGUGGAAAAAUUGGAAUC
>hsa-miR-194* MIMAT0004671 CCAGUGGGGCUGCUGUUAUCUG
>hsa-miR-140-5p MIMAT0000431 CAGUGGUUUUACCCUAUGGUAG