Skip to main content

Table 2 qRT-PCR primers used to detect endogenous and transfection constructed transcribed Rnf14 mRNA species

From: RNF14 is a regulator of mitochondrial and immune function in muscle

Transcripts 5'primer 3'primer
Rnf14 all endogenous and all transfection construct ctcaactgtccagagccaca catggtaccaccaggctctt
Rnf14 all endogenous only gccccattgtgttctcaact gagccatgatgctcttcaca
Rnf14 variant 1 transfection construct aattgaggaggacgacgatg aggaactgcttccttcacga
Rnf14 variant 3 transfection construct aattgaggaggacgacgatg cgtagaatcgagaccgagga
Actb gtgggccgccctaggcaccag ctctttgatgtcacgcacgatttc
  1. Transciption from the Actb gene was used as a control. A schematic of the known mouse Rnf14 mRNA species is presented in FigureĀ 1.