RNF14 is a regulator of mitochondrial and immune function in muscle

BMC Systems Biology

Table 2 qRT-PCR primers used to detect endogenous and transfection constructed transcribed Rnf14 mRNA species

Transcripts	5'primer	3'primer
Rnf14 all endogenous and all transfection construct	ctcaactgtccagagccaca	catggtaccaccaggctctt
Rnf14 all endogenous only	gccccattgtgttctcaact	gagccatgatgctcttcaca
Rnf14 variant 1 transfection construct	aattgaggaggacgacgatg	aggaactgcttccttcacga
Rnf14 variant 3 transfection construct	aattgaggaggacgacgatg	cgtagaatcgagaccgagga
Actb	gtgggccgccctaggcaccag	ctctttgatgtcacgcacgatttc

Transciption from the Actb gene was used as a control. A schematic of the known mouse Rnf14 mRNA species is presented in Figure 1.

ISSN: 1752-0509