Skip to main content

Advertisement

Table 4 Primers used for real-time qRT-PCR

From: Iron acquisition and oxidative stress response in aspergillus fumigatus

Gene   Primer sequence (5’-3’) melting Product
    Tm ( C) size(bp)
β-tubuliln FP CTGCTCTGCCATTTTCCGTG 56.8 119
  RP CGGTCTGGATGTTGTTGGGA 57.3  
sidA FP TGACGACTCGCCTTTTGTGAA 57.0 474
  RP TTGCTCGGGTCCATCTCAAC 57.3  
sreA FP CTCAGTACGATCGCTTCCCC 57.3 297
  RP GTCCCACAATTACTGCACGA 55.2  
ftrA FP GGCATGATCGGAGCGTTCTA 57.1 411
  RP GGCTTGGTTTCCTCCTCGAT 57.2  
cccA FP GAGCCAAGAGTGAGGCAGAA 57.0 448
  RP TGCACACCACCCTTGATACC 57.4