Skip to main content

Advertisement

Table 2 RT-PCR used primer sequences

From: Incorporating genomic, transcriptomic and clinical data: a prognostic and stem cell-like MYC and PRC imbalance in high-risk neuroblastoma

Gene Primer sequences used for amplifications
GAPDH-F 5′ GGAGTCCACTGGCGTCTTC 3′
GAPDH-R 5’ATCTTGAGGCTGTTGTCATACTTC3’
ZFHX3-F 5′ TTCTTTTCCTCCTCTCTCCTCATC 3′
ZFHX3-R 5′ CGGTCCGTCGGACTTTTG 3′