Skip to main content

Advertisement

Table 2 Nucleotide sequences of primers used for quantitative real-time PCR

From: Effects of unpaired 1 gene overexpression on the lifespan of Drosophila melanogaster

Gene Forward primer (5′-3′) Reverse primer (5′-3′) Product length (in bp) Expected efficiency
upd1 agacagccgtcaaccagac gcttcaaacgcttgttcatc 141 > 2
domeless tcgctacatgacaacgtgaccgat acgcacgctaatctcgtacttggt 132 > 2
Socs36E gggcaaacagaacccagaaaccaa tccgagctgcattccaataggtga 189 > 2
βTub56D gcaactccactgccatcc cctgctcctcctcgaact 216 > 2