Strains | Relevant characteristics | Sources |
---|---|---|
B | Wild type | ATCC11303 |
SZ420 | E. coli B, ΔfrdBC ΔldhA ΔackA Δ(focA-pflB) ΔpdhR::pflBp (6)-(aceEF-lpd) | Zhou et al. [28] |
AI03 | E. coli SZ420, ΔadhE | Iverson et al. [13] |
AI05 | E. coli SZ420, ΔadhE ΔptsG | Iverson et al. [13] |
AI09 | E. coli SZ420, ΔadhE ΔptsG ΔxylB | This study |
AI12 | E. coli SZ420, ΔadhE ΔptsG ΔxylB ΔsdhCp::Fnr box- pflBp (6)-(sdhCDBA-sucABCD) | This study |
AI21 | E. coli SZ420, ΔadhE ΔptsG ΔxylB ΔxylA ΔsdhCp::Fnr box- pflBp (6)-(sdhCDBA-sucABCD) | This study |
Plasmids | Â | Â |
pKD4 | bla, FRT-km-FRT | Datsenko and Wanner [10] |
pKD46 | bla, γ β exo (red recombinase), temperature-conditional replicon | Datsenko and Wanner [10] |
pFT-A | bla, flp, temperature-conditional replicon | Posfai et al. [19] |
pUC19 | bla cloning vector | NE Biolab |
pSD105 | PCR amplified 0.35Â kb pflB promoter region (BamHI- pflBp 6-HindIII) was inserted into pSD101 at BamHI and HindIII sites | Zhou et al. [29] |
pAGI02 | PCR amplified 0.966Â kb xylI region from C. boidinii was inserted into pSD105 at HindIII site | Iverson et al. [13] |
Primersa | Â | Â |
ΔxylB N-primer | atgtatatcgggatagatcttggcacctcgggcgtaaaagttattgtgtaggctggagatgcttc | This study |
ΔxylB C-primer | ttacgccattaatggcagaagttgctgatagaggcgacggaacgtcatatgatatcctccttag | This study |
ΔxylA N-primer | ccgcggcattacctgattatggagttcaatatgcaagcctattttggtgtaggctggagatgcttc | This study |
ΔxylA C-primer | gttatttgtcgaacagataatggtttaccagattttccagttgttccatatgaatatcctccttag | This study |
Integration primer 1 | ccgacaaactatatgtaggttaattgtaatgattttgtgaacagcctatactgccgccag gtgtaggctggagctgcttc (used as N-terminal primer for amplifying FRT-kan-FRT-Fnr box- pflBp (6)-sdhC’) | This study |
Integration primer 2 | gaaccggatggtctgtaggtccagattaacaggtctttgttttttcacatttcttatcat gtaacacctaccttctgttgctgtgatatagaagac (used as C-terminal primer for amplifying FRT-kan-FRT- pflBp 6-sdhC’) | This study |
rrsA primer 1 | cggtggagcatgtggtttaa (used for qt-PCR) | Nishino et al. [18] |
rrsA primer 2 | gaaaacttccgtggatgtcaaga(used for qt-PCR) | Nishino et al. [18] |
sdhC primer 1 | cgccagccgcccagcacag (used for qt-PCR) | This study |
sdhC primer 2 | ggtatggaaggtctgttccgtcagattggtatttacagccc (used for qt-PCR) | This study |
sucA primer 1 | cagggcggttgcttcaccatctcca (used for qt-PCR) | This study |
sucA primer 2 | gcggcacgaactctttaccattccacacc (used for qt-PCR) | This study |