Skip to main content

Table 2 Primers used for qRT-PCR validation

From: Deducing corticotropin-releasing hormone receptor type 1 signaling networks from gene expression data by usage of genetic algorithms and graphical Gaussian models

gene 5' → 3'
Acsl4 fwd GGAGCCAAGCCAGAAAAC
Acsl4 rev GCCTGTCATTCCAGCAATC
Crem fwd ACATGCCAACTTACCAGATCC
Crem rev TTTTCAAGCACAGCCACAC
Fosl2 fwd GGTAGATATGCCTGGCTCGG
Fosl2 rev TCATCTCTCCTTCTGCGGCC
Gapdh fwd CCATCACCATCTTCCAGGAGCGAG
Gapdh rev GATGGCATGGACTGTGGTCATGAG
Hprt fwd ACCTCTCGAAGTGTTGGATACAGG
Hprt rev CTTGCGCTCATCTTAGGCTTTG
Hmgcs1 fwd AATGCCGTGAACTGGGTCG
Hmgcs1 rev TGAGGTAGCACTGTATGGAGAGC
Nf2 fwd TTCAAGAGATCACGCAACAC
Nf2 rev TTCTCTCCTCCCACATTTCC
Pex13 fwd TCCTGTTCTTTGCTGTTATCC
Pex13 rev TCATCCTCACCACTTGCC