Cells and cell culture
We cultured the human bronchial epithelial cell line BEAS-2B (ATCC CRL-9609) and the mouse macrophage RAW 264.7 cell line in RPMI-1640 (Invitrogen, USA) supplemented with 10% FBS. Human epidermoid carcinoma cell line A431 was cultured in DMEM (GIBCO) supplemented with 10% heat-inactivated fetal bovine serum. All cells were cultured at 37°C in an incubator under 5% CO2 and 95% air.
Transfection
The plasmids pEGFPC1 and pEGFPN1-ECPsp were individually transfected into BEAS-2B cells using TurboFectTM (Thermo Fisher Scientific Inc., USA). For the transfection, 2 × 106 BEAS-2B or A431 cells were seeded onto a 100-mm culture plate. After 24 h in culture (~80-90% confluency), 3 μg of plasmid DNA and 6 μl of TurboFectTM reagent were mixed in 1 ml of serum-free RPMI-1640. The transfection mixture was gently vortexed and incubated for 15 min at room temperature to allow the formation of transfection complexes. The 1-ml transfection mixture was then added drop-wise to the cells and incubated at 37°C for another 48 h, at which point the cells were harvested for RNA isolation and Western blotting.
For plasmid and siRNA co-transfection, 3 × 105 BEAS-2B cells were seeded onto a 60-mm culture plate. After 24 h, the pEGFPN1-ECPsp and siRNA (against STAT1 or STAT2, final concentration: 50 nM) were added into 200 μl jetPRIME® buffer (Polyplus-transfection) and mixed by pipetting. Then, 8 μl jetPRIME® reagent was added. The transfection mixture was gently vortexed, and incubated at room temperature. After 15 min, the transfection mixture was added drop-wise to the cells and incubated at 37°C. The original medium was replaced by fresh one at 24 h post-transfection. After additional 24 h, the cell lysates were harvested for Western blotting.
RNA extraction and cDNA preparation
Total RNA from BEAS-2B cells was isolated using TRIzol reagent (Invitrogen, USA). Cells that had been cultured in a 100-mm dish were washed with cold PBS. TRIzol reagent (1 ml) was added, and the cells were lysed by pipetting the mixture up and down several times. The cell lysate was then transferred to a 1.5-ml microcentrifuge tube. After the addition of 300 μl of cold chloroform (Sigma, USA), the lysate was gently mixed for 15 seconds, incubated on ice for 15 min, and then centrifuged at 10,000 ×g at 4°C for 15 min. The RNA, which remained exclusively in the aqueous phase, was transferred to a new tube. An equal volume of 100% isopropanol was then added and mixed gently by inverting the microcentrifuge tube repeatedly. The precipitated RNA was recovered by centrifugation at 12,000 rpm for 15 min at 4°C. After removal of the supernatant, the RNA pellet was washed twice with 75% ethanol dissolved in diethylpyrocarbonate (DEPC)-treated water and then air-dried. The RNA was dissolved in sterile DEPC-treated water. RT-PCR was used to determine gene expression based on the level of RNA abundance. Total RNA (2 μg) and 1 μl of 10 μM oligo-dT primer (MDBio, Taiwan) were mixed in DEPC-treated water and heated at 70°C for 5 min. The reverse transcription mixture containing 5 μl of Moloney Murine Leukemia Virus (M-MLV) 5× reaction buffer (Promega, USA), 5 μl of 2.5 mM dNTP (2.5 mM each of dATP, dTTP, dCTP, and dGTP; Protech, Taiwan), 1 μl of M-MLV reverse transcriptase (Promega, USA), and DEPC-treated water added to a final volume of 20 μl. The cDNA was generated at 42°C.
Semi-quantitative RT-PCR
Coding regions of the genes CCL5, CXCL10, CXCL11, CXCL16, STAT1, STAT2, and GAPDH were amplified using the following primer sets: CCL5-F’ (ccctcgctgtcatcctcattg)/CCL5-R’ (gtgacaaagacgactgctgg), CXCL10-F’ (ggcattcaaggagtacctct)/CXCL10-R’ (attcagacatctcttctcac), CXCL11-F’ (agttgttcaaggcttccccatg)/CXCL11-R’ (gggatttaggcatcgttgtcc), CXCL16-F’ (actcagccaggcaatggcaa)/CXCL16-R’ (tccaggaaaggagctggaac), STAT1-F’ (tgcgcgcagaaaagtttcat)/STAT1-R’ (ggattcaaccaaaggagcag), STAT2-F’ (ccagaactggcaggaagctg)/STAT2-R’ (atgtcccggcagaatttccg), and GAPDH-F’ (accacagtccatgccatcac)/GAPDH-R’ (tccaccaccctgttgctgta), respectively. cDNA (1 μl) was used as the template and was mixed with 0.5 μl of each primer (10 μM), 2 μl of dNTP (Protech, Taiwan), 0.25 μl of GoTaq Flexi DNA polymerase (5 U/μl; Promega, USA), 4 μl of 5× Colorless GoTaq reaction buffer (Promega, USA), 1.2 μl of 25 mM MgCl2, and sterile deionized water to a final volume of 20 μl. The sample was heated at 95°C for 5 min, followed by 30 cycles, each comprising 95°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec, and one cycle of 72°C for 10 min in a thermocycler (Multigene, USA).
DNA microarray analysis
The Human Whole Genome OneArray® v5 (HOA; Phalanx Biotech Group, Taiwan) has in total 30,275 DNA oligonucleotide probes, and each probe has 60 nucleotides in the sense strand. Of these probes, 29,187 probes correspond to the annotated genes in the RefSeq v38 and Ensembl v56 databases. Furthermore, 1,088 control probes are also included for monitoring the sample quality and the hybridization process. Fluorescent aRNA targets were prepared from 1.0 μg total RNA samples using OneArray® Amino Allyl aRNA Amplification Kit (Phalanx Biotech Group, Taiwan) and Cy5 dyes (Amersham Pharmacia, Piscataway, NJ, USA). Fluorescent targets were hybridized to the Human Whole Genome OneArray® with Phalanx hybridization buffer using Phalanx Hybridization System. After 16-hr hybridization at 50°C, non-specific binding targets were washed away by three different washing steps (Wash I: at 42°C for 5 min; Wash II: at 42°C for 5 min and subsequent one at 25°C for 5 min; and Wash III: rinsing the chips for 20 times), and the slides were dried by centrifugation and scanned by an Axon 4000B scanner (Molecular Devices, Sunnyvale, CA, USA). The Cy5 fluorescent intensities of each spot were analyzed by GenePix 4.1 software (Molecular Devices). The signal intensity of each spot was loaded into the Rosetta Resolver System® (Rosetta Biosoftware) for data analysis[43]. The error model of the Rosetta Resolver System® removed both systematic and random errors from the data. We filtered out spots for which the flag was less than zero. Spots that passed the criterion for further consideration were normalized using the 50% media scaling normalization method. The technical repeat data were tested by calculating the Pearson correlation coefficient to assess reproducibility (r >0.975). To identify the differentially expressed genes, we calculate the log2 ratio of the normalized intensity of treatment sample over intensity of control sample as follows,
where It is one probe intensity of the treatment sample, Ic is one probe intensity of control sample. If a probe P’s R value is bigger than the threshold (usually set as 1), P is regarded as different expression on treatment and control. Furthermore we can calculate the p-value p (differential expression) to test the statistical significance of R, which means the probability of null hypothesis that treatment sample and control sample are not differential expression for one probe. The detailed procedure to estimate p is formally described in[43]. In our implementation, the spots with p <0.05 and R ≥1 were identified as differentially expressed genes for further pathway analysis. The DNA microarray data has been submitted to and approved by the Gene Expression Omnibus Database (GEO) with an accession number of GSE39122.
String
According to the gene expression profiles derived from DNA microarray, 93 genes upregulated more than 2-fold (log2 ≥1) and with the statistic p less than 0.05 were selected and assembled as a gene expression subdataset (Table1). The functional linkage network was generated using STRING 9.0 database[44]. The gene symbols listed in the gene expression subdataset were input into the frame of “multiple names” in STRING and the organism was set Homo sapiens. After executing the search, STRING would show the possible genes we input and we had to select correct ones. Then, the functional linkage could be generated using the default setting. Within this completely functional network, the evident area of dense interconnections could be identified. In this network, 93 nodes are connected by 676 edges, and in the dense area, there are 618 edges to connect at least one of the 40 nodes. Although only 43.1% (40/93) of nodes are located in the dense area, there are 91.42% (618/676) edges to connect the nodes in dense area with other nodes.
Furthermore, to analyze the relationship of the functional network, and the TGF-α/EGFR pathway which we discovered previously[22], the genes within the evident area, TGF-α and EGFR were input into STRING again. The setting of STRING database is also default. Then, the functional network linked evident area and TGF-α/EGFR pathway could be generated. The figures presented here are redrawn using Cytoscape software which could calculate the numbers of nodes and edges efficiently.
NOA
The NOA (http://app.aporc.org/NOA) database was designed for identifying the enrichment of gene ontology based on biological networks as classified by systems biology[24]. According to microarray data (Table1), the 93 genes of interest were input into and analyzed by the NOA server to determine the relationship of network ontology.
Western blotting
After SDS-PAGE analysis, the proteins were transferred onto a polyvinylidene fluoride (PVDF) membrane (Pall, Pensacola). The membrane was incubated in 5% fetal bovine serum (FBS) in PBST (1X PBS and 0.1% Tween 20) at room temperature for 1 h and then the diluted antibody (anti-STAT1 mAb, 1:2,500 or anti-STAT2 mAb, 1:2,500, Santa Cruz, USA) in 5% FBS/PBST was added to react with the target proteins with shaking at 4°C for 16 h. The membrane was washed with PBST three times for 15 min each. The secondary antibody (anti-rabbit IgG conjugated with HRP, 1:5,000, Jackson, USA) was diluted in 3% Milk/PBST with shaking at 25°C. After 1.5 h, the membrane was washed with PBST for three times and the target protein was visualized by addition of the mixture of reagents A and B (Pierce) to the PVDF membrane, and exposed by the ImageQuantTM LAS 4000 (GE Healthcare).
Macrophage migration assay
Migration assays were performed in Transwell plates (Corning Costar, USA) with a 6.5-mm diameter and an 8-μm pore size for the membrane. Conditioned medium was prepared before adding RAW 264.7 cells into the top well. The BEAS-2B cells were seeded in 60-mm dishes. After 24 h, both plasmids (pEGFP-C1 and pEGFP-N1-ECPsp) were transfected into BEAS-2B cells (as described above) for 6 h. The culture medium containing the transfection mixture was removed, and fresh RPMI-1640 medium supplemented with 10% FBS was added for a further 18-h incubation at 37°C in a humidified 5% CO2 incubator. The culture medium was removed, and fresh serum-free RPMI-1640 was added prior to incubation at 37°C for 24 h. Three hundred microliters of the serum-free medium was collected, centrifuged to remove the debris, and then transferred into the bottom wells. At the same time, 1.5 × 105 RAW 264.7 cells were transferred to each top well. After incubation for 8 h at 37°C, cells in the top wells were fixed using 3.7% formaldehyde for 5 min and then stained with 0.05% crystal violet for 30 min, with three further rinses with PBS. The number of cells migrating to the lower membrane surface was counted, and these data were used for further two-tailed student’s t test analysis.
